CodeGuru Home VC++ / MFC / C++ .NET / C# Visual Basic VB Forums Developer.com
+ Reply to Thread
Results 1 to 4 of 4
  1. #1
    Join Date
    Jul 2012
    Posts
    2

    MATLAB programming

    I am new to Matlab software and have a bugging project to write a program that would read a heavy load of data. The data is in a file that contains T,G,A,C (DNA sequences) at different variations. I want to use Matlab to be able to count through these nucleotides. For example, my data looks thus;

    ATAAGGCACATTAGCATGACTCCTCTGCTACCACACATTATA(about millions of these sequences). I have values for each of these nucleotide combinations, I want a program that will be able to read the data in this way AT,TA,AA,AG,GG (this is the same data above but read 1 and 2, 2 and 3, 3 and 4 and so on... ) I want to be able to assign values to each of these combinations in this format;
    AT TA AA
    1.3 3.5 1.0 and so on.

    Can someone help out with how i can do this with Matlab or any program please?

    Thanks in anticipation of your positive response

  2. #2
    Join Date
    Nov 2000
    Location
    Voronezh, Russia
    Posts
    5,536

    Re: MATLAB programming

    What does it have to do with multithreading?
    Best regards,
    Igor

  3. #3
    Join Date
    Jul 2012
    Posts
    2

    Re: MATLAB programming

    I don't know what the right heading should be...

  4. #4
    Join Date
    Mar 2001
    Posts
    2,353

    Re: MATLAB programming

    You need to find a MATLAB list. This list is not specific to the product or subject matter you want to use.
    ahoodin
    To keep the plot moving, that's why.

+ Reply to Thread

Tags for this Thread

Bookmarks

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts



HTML5 Development Center

Click Here to Expand Forum to Full Width