MATLAB programming

I am new to Matlab software and have a bugging project to write a program that would read a heavy load of data. The data is in a file that contains T,G,A,C (DNA sequences) at different variations. I want to use Matlab to be able to count through these nucleotides. For example, my data looks thus;

ATAAGGCACATTAGCATGACTCCTCTGCTACCACACATTATA(about millions of these sequences). I have values for each of these nucleotide combinations, I want a program that will be able to read the data in this way AT,TA,AA,AG,GG (this is the same data above but read 1 and 2, 2 and 3, 3 and 4 and so on... ) I want to be able to assign values to each of these combinations in this format;
AT TA AA
1.3 3.5 1.0 and so on.

Can someone help out with how i can do this with Matlab or any program please?

Thanks in anticipation of your positive response

What does it have to do with multithreading?

I don't know what the right heading should be...

You need to find a MATLAB list. This list is not specific to the product or subject matter you want to use.