CodeGuru Home VC++ / MFC / C++ .NET / C# Visual Basic VB Forums Developer.com
Results 1 to 4 of 4
  1. #1
    Join Date
    Jul 2012
    Posts
    2

    MATLAB programming

    I am new to Matlab software and have a bugging project to write a program that would read a heavy load of data. The data is in a file that contains T,G,A,C (DNA sequences) at different variations. I want to use Matlab to be able to count through these nucleotides. For example, my data looks thus;

    ATAAGGCACATTAGCATGACTCCTCTGCTACCACACATTATA(about millions of these sequences). I have values for each of these nucleotide combinations, I want a program that will be able to read the data in this way AT,TA,AA,AG,GG (this is the same data above but read 1 and 2, 2 and 3, 3 and 4 and so on... ) I want to be able to assign values to each of these combinations in this format;
    AT TA AA
    1.3 3.5 1.0 and so on.

    Can someone help out with how i can do this with Matlab or any program please?

    Thanks in anticipation of your positive response

  2. #2
    Join Date
    Nov 2000
    Location
    Voronezh, Russia
    Posts
    6,633

    Re: MATLAB programming

    What does it have to do with multithreading?
    Best regards,
    Igor

  3. #3
    Join Date
    Jul 2012
    Posts
    2

    Re: MATLAB programming

    I don't know what the right heading should be...

  4. #4
    Join Date
    Mar 2001
    Posts
    2,529

    Re: MATLAB programming

    You need to find a MATLAB list. This list is not specific to the product or subject matter you want to use.
    ahoodin
    To keep the plot moving, that's why.

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  





Click Here to Expand Forum to Full Width

Featured